Finding of novel telomeric repeats and their distribution in the human genome

Sathyalakshmi Alaguponniah; Deepa Velayudhan Krishna; Sayan Paul; Johnson Retnaraj Samuel Selvan Christyraj; Krishnan Nallaperumal; Sudhakar Sivasubramaniam

doi:10.1016/j.ygeno.2020.04.010

Finding of novel telomeric repeats and their distribution in the human genome

Sathyalakshmi Alaguponniah, Deepa Velayudhan Krishna, Sayan Paul, Johnson Retnaraj Samuel Selvan Christyraj, Krishnan Nallaperumal, Sudhakar Sivasubramaniam

Research output: Contribution to journal › Article › peer-review

Abstract

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats “CACAGA” and “TCTCTGCGCCTGCGCCGGCGCGGCGCGCC” and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

Original language	English (US)
Pages (from-to)	3565-3570
Number of pages	6
Journal	Genomics
Volume	112
Issue number	5
DOIs	https://doi.org/10.1016/j.ygeno.2020.04.010
State	Published - Sep 2020
Externally published	Yes

Keywords

Aging
Loop
Novel repeats
Telomere

ASJC Scopus subject areas

Genetics

Access to Document

10.1016/j.ygeno.2020.04.010

Cite this

@article{c45aa6627a79497f8a20be85195e6025,

title = "Finding of novel telomeric repeats and their distribution in the human genome",

abstract = "Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats “CACAGA” and “TCTCTGCGCCTGCGCCGGCGCGGCGCGCC” and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.",

keywords = "Aging, Loop, Novel repeats, Telomere",

author = "Sathyalakshmi Alaguponniah and {Velayudhan Krishna}, Deepa and Sayan Paul and Christyraj, {Johnson Retnaraj Samuel Selvan} and Krishnan Nallaperumal and Sudhakar Sivasubramaniam",

note = "Publisher Copyright: {\textcopyright} 2020 Elsevier Inc.",

year = "2020",

month = sep,

doi = "10.1016/j.ygeno.2020.04.010",

language = "English (US)",

volume = "112",

pages = "3565--3570",

journal = "Genomics",

issn = "0888-7543",

publisher = "Academic Press Inc.",

number = "5",

}

TY - JOUR

T1 - Finding of novel telomeric repeats and their distribution in the human genome

AU - Alaguponniah, Sathyalakshmi

AU - Velayudhan Krishna, Deepa

AU - Paul, Sayan

AU - Christyraj, Johnson Retnaraj Samuel Selvan

AU - Nallaperumal, Krishnan

AU - Sivasubramaniam, Sudhakar

PY - 2020/9

Y1 - 2020/9

N2 - Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats “CACAGA” and “TCTCTGCGCCTGCGCCGGCGCGGCGCGCC” and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

AB - Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats “CACAGA” and “TCTCTGCGCCTGCGCCGGCGCGGCGCGCC” and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

KW - Aging

KW - Loop

KW - Novel repeats

KW - Telomere

UR - http://www.scopus.com/inward/record.url?scp=85083548203&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=85083548203&partnerID=8YFLogxK

U2 - 10.1016/j.ygeno.2020.04.010

DO - 10.1016/j.ygeno.2020.04.010

M3 - Article

C2 - 32320819

AN - SCOPUS:85083548203

SN - 0888-7543

VL - 112

SP - 3565

EP - 3570

JO - Genomics

JF - Genomics

IS - 5

ER -

Finding of novel telomeric repeats and their distribution in the human genome

Abstract

Keywords

ASJC Scopus subject areas

Access to Document

Other files and links

Fingerprint

Cite this